ensembl-hive  2.7.0
Bio::EnsEMBL::DBSQL::SequenceAdaptor Class Reference
+ Inheritance diagram for Bio::EnsEMBL::DBSQL::SequenceAdaptor:

Public Member Functions

public Bio::EnsEMBL::DBSQL::SequenceAdaptor new ()
 
public String fetch_by_Slice_start_end_strand ()
 
public can_access_Slice ()
 
protected _fetch_by_Slice_start_end_strand_circular ()
 
protected _rna_edit ()
 
protected _fetch_raw_seq ()
 
public void store ()
 
public void remove ()
 
protected _populate_seq_region_edits ()
 
- Public Member Functions inherited from Bio::EnsEMBL::DBSQL::BaseAdaptor
public Bio::EnsEMBL::DBSQL::BaseAdaptor new ()
 
public DBI::StatementHandle prepare ()
 
public Bio::EnsEMBL::DBSQL::DBAdaptor db ()
 
public Bio::EnsEMBL::DBSQL::DBConnection dbc ()
 
public Boolean is_multispecies ()
 
public Int species_id ()
 
protected _list_dbIDs ()
 
protected _straight_join ()
 
protected _can_straight_join ()
 
public Listref bind_param_generic_fetch ()
 
protected _bind_param_generic_fetch ()
 
public String generate_in_constraint ()
 
public Listref generic_fetch ()
 
public Int generic_count ()
 
protected _generate_sql ()
 
public Bio::EnsEMBL::Feature fetch_by_dbID ()
 
protected _uncached_fetch_by_dbID ()
 
public Listref fetch_all_by_dbID_list ()
 
protected _uncached_fetch_all_by_dbID_list ()
 
protected ArrayRef _uncached_fetch_all_by_id_list ()
 
public fetch_all ()
 
public Scalar last_insert_id ()
 
public insert_ignore_clause ()
 
protected Bio::EnsEMBL::DBSQL::Support::BaseCache _id_cache ()
 
protected Boolean _no_id_cache ()
 
public Boolean ignore_cache_override ()
 
public Int schema_version ()
 
protected _tables ()
 
protected _columns ()
 
protected _default_where_clause ()
 
protected _left_join ()
 
protected _final_clause ()
 
protected _objs_from_sth ()
 
protected _build_id_cache ()
 
protected _logic_name_to_constraint ()
 
- Public Member Functions inherited from Bio::EnsEMBL::DBSQL::BaseSequenceAdaptor
public StringRef fetch_by_Slice_start_end_strand ()
 
public Boolean can_access_Slice ()
 
public Bio::EnsEMBL::Slice expand_Slice ()
 
public Bio::EnsEMBL::DBSQL::SequenceAdaptor new ()
 
protected _init_seq_instance ()
 
public void clear_cache ()
 
public chunk_power ()
 
public cache_size ()
 
public seq_cache_max ()
 
protected ScalarRef _fetch_raw_seq ()
 
protected ScalarRef _fetch_seq ()
 

Detailed Description

Synopsis

my $sa = $registry->get_adaptor( 'Human', 'Core', 'Sequence' );
my $dna =
${ $sa->fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) };

Description

An adaptor for the retrieval of DNA sequence from the EnsEMBL database

Definition at line 22 of file SequenceAdaptor.pm.

Member Function Documentation

◆ _fetch_by_Slice_start_end_strand_circular()

protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_by_Slice_start_end_strand_circular ( )

Undocumented method

Code:
click to view

◆ _fetch_raw_seq()

protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_raw_seq ( )
  Description : Communicates with the database to fetch back sequence
 
Code:
click to view

◆ _populate_seq_region_edits()

protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_populate_seq_region_edits ( )
  Description:  Query the database for any _rna_edit attributes attached to a seq region
 
Code:
click to view

◆ _rna_edit()

protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_rna_edit ( )
  Description : Performs within sequence region editting when 
                the underlying sequence is incorrect. Used by LRGs.
 
Code:
click to view

◆ can_access_Slice()

public Bio::EnsEMBL::DBSQL::SequenceAdaptor::can_access_Slice ( )
  Description : Returns 1 since we can access any Slice's data
 
Code:
click to view

◆ fetch_by_Slice_start_end_strand()

public String Bio::EnsEMBL::DBSQL::SequenceAdaptor::fetch_by_Slice_start_end_strand ( )
  Arg  [1]   : Bio::EnsEMBL::Slice slice
               The slice from which you want the sequence
  Arg  [2]   : (optional) int startBasePair 
               The start base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine.
               default = 1
  Arg  [3]   : (optional) int endBasePair
               The end base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine,
               but the end must be greater than or equal to the start
               count from 1
               default = the length of the slice
  Arg  [4]   : (optional) int strand 
               1, -1
               default = 1
  Example    :
$dna = $seq_adptr->fetch_by_Slice_start_end_strand($slice, 1,
1000, -1);
  Description: Retrieves from db the sequence for this slice
               uses AssemblyMapper to find the assembly
  Returntype : string 
  Exceptions : endBasePair should be less or equal to length of slice 
  Caller     : Bio::EnsEMBL::Slice::seq(), Slice::subseq() 
  Status     : Stable
 
Code:
click to view

◆ new()

public Bio::EnsEMBL::DBSQL::SequenceAdaptor Bio::EnsEMBL::DBSQL::SequenceAdaptor::new ( )
  Arg [1]    : none
  Example    :
my $sa = $db_adaptor->get_SequenceAdaptor();
  Description: Constructor. Calls superclass constructor and initialises
               internal cache structure.
  Returntype : Bio::EnsEMBL::DBSQL::SequenceAdaptor
  Exceptions : none
  Caller     : DBAdaptor::get_SequenceAdaptor
  Status     : Stable
 
Code:
click to view

◆ remove()

public void Bio::EnsEMBL::DBSQL::SequenceAdaptor::remove ( )
   
  Arg [1]    : int $seq_region_id the id of the sequence region this dna   
               is associated with.   
  Example    :

@co
de $seq_adaptor->remove(11);

  Description: removes a dna sequence for a given seq_region_id    
  Returntype : none    
  Exceptions : throw if the database delete fails    
  Caller     : Internal    
  Status     : Stable
 


Code:
click to view

◆ store()

public void Bio::EnsEMBL::DBSQL::SequenceAdaptor::store ( )
  Arg [1]    : int $seq_region_id the id of the sequence region this dna
               will be associated with.
  Arg [2]    : string $sequence the dna sequence to be stored 
               in the database.  Note that the sequence passed in will be
               converted to uppercase.
  Example    :
$seq_adaptor->store(11, 'ACTGGGTACCAAACAAACACAACA');
  Description: stores a dna sequence in the databases dna table and returns the
               database identifier for the new record.
  Returntype : none
  Exceptions : throw if the database insert fails
  Caller     : sequence loading scripts
  Status     : Stable
 
Code:
click to view

The documentation for this class was generated from the following file:
Bio::EnsEMBL::DBSQL::SequenceAdaptor::store
public void store()
Bio::EnsEMBL::DBSQL::BaseAdaptor::species_id
public Int species_id()
Bio::EnsEMBL::DBSQL::BaseAdaptor::dbc
public Bio::EnsEMBL::DBSQL::DBConnection dbc()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_raw_seq
protected _fetch_raw_seq()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::remove
public void remove()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_by_Slice_start_end_strand_circular
protected _fetch_by_Slice_start_end_strand_circular()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::_populate_seq_region_edits
protected _populate_seq_region_edits()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::_rna_edit
protected _rna_edit()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::fetch_by_Slice_start_end_strand
public String fetch_by_Slice_start_end_strand()
Bio::EnsEMBL::DBSQL::SequenceAdaptor::can_access_Slice
public can_access_Slice()